news
3 ΩΡΕΣ ΠΡΙΝ

Φόνος «Μαριούθκια: Ξεσκονίζουν πτήσεις του εξωτερικού για εισαγόμενους εκτελεστές [ΒΙΝΤΕΟ]

Στο κάδρο των ερευνών το ενδεχόμενο πίσω από το συμβόλαιο θανάτου να βρίσκονται επαγγελματίες εκτελεστές από το εξωτερικό.

2 ΩΡΕΣ ΠΡΙΝ

Τη διαφοροποίηση του «κέρφιου» το Μ. Σάββατο προκρίνουν οι ειδικοί [ΒΙΝΤΕΟ]

Όλα όσα αποφάσισε χθες το βράδυ η επιδημιολογική ομάδα.

1 ΩΡΑ ΠΡΙΝ

Χάραξαν γραμμή Αναστασιάδης – Μητσοτάκης ενόψει της άτυπης πενταμερούς

Ο Πρόεδρος της Κυπριακής Δημοκρατίας υπογράμμισε ότι προσπάθεια δεν είναι ο σφετερισμός των δικαιωμάτων οποιουδήποτε.

5 ΩΡΕΣ ΠΡΙΝ

Ψάχνουν νέους τρόπους χρήσης των εμβολίων οι αρμόδιοι

Στο μικροσκόπιο και οι πρακτικές άλλων χωρών. Εντός της εβδομάδας θα παραληφθούν άλλες 55 χιλιάδες δόσεις εμβολίων.

1 ΩΡΑ ΠΡΙΝ

Μόνο μια ημέρα θα παραμένει ανοικτή η Πύλη Εμβολιασμού για κάθε ηλικιακή ομάδα [ΒΙΝΤΕΟ]

Η νέα απόφαση αφορά στο ότι η Πύλη θα παραμένει ανοικτή για κάθε ηλικιακή ομάδα μόνο για μια μέρα. Με

5 ΩΡΕΣ ΠΡΙΝ

Παγκύπριες Εξετάσεις: Σε χωριστές αίθουσες με συνοδεία νοσηλευτών τα θετικά κρούσματα

Εντός των επόμενων ημερών αναμένεται το υγειονομικό πρωτόκολλο για τις Παγκύπριες Εξετάσεις.

3 ΩΡΕΣ ΠΡΙΝ

Φόνος «Μαριούθκια: Ξεσκονίζουν πτήσεις του εξωτερικού για εισαγόμενους εκτελεστές [ΒΙΝΤΕΟ]

2 ΩΡΕΣ ΠΡΙΝ

Τη διαφοροποίηση του «κέρφιου» το Μ. Σάββατο προκρίνουν οι ειδικοί [ΒΙΝΤΕΟ]

1 ΩΡΑ ΠΡΙΝ

Χάραξαν γραμμή Αναστασιάδης – Μητσοτάκης ενόψει της άτυπης πενταμερούς

5 ΩΡΕΣ ΠΡΙΝ

Ψάχνουν νέους τρόπους χρήσης των εμβολίων οι αρμόδιοι

1 ΩΡΑ ΠΡΙΝ

Μόνο μια ημέρα θα παραμένει ανοικτή η Πύλη Εμβολιασμού για κάθε ηλικιακή ομάδα [ΒΙΝΤΕΟ]

5 ΩΡΕΣ ΠΡΙΝ

Παγκύπριες Εξετάσεις: Σε χωριστές αίθουσες με συνοδεία νοσηλευτών τα θετικά κρούσματα

Τελευταία επεισόδια

Από τις παραγωγές του ΑΝΤ1

Σε ελλειπή ενημέρωση από το Υπ. Εργασίας, αναφέρεται η ΕΚΥΣΥ

Δεν ενημερώθηκαν για το δικαίωμα που είχαν και έχουν όπως υποβάλουν αίτηση για σύνταξη από το Ταμείο Κοινωνικών Ασφαλίσεων είτε θεσμοθετημένη είτε κοινωνική όσοι συμπλήρωσαν το 65ο έτος της ηλικίας τους και είναι πρώην λήπτες δημόσιου βοηθήματος...

5' ΠΡΙΝ

Στο κελί για 6 ημέρες ο 22χρονος που κυκλοφορούσε με κάνναβη και μεθαμφεταμίνη

Διάταγμα κράτησης, για περίοδο έξι ημερών, εξέδωσε το Επαρχιακό Δικαστήριο Λεμεσού εναντίον...

6' ΠΡΙΝ

Καταθέτει την Πέμπτη στην Ερευνητική Επιτροπή των Κατ’ Εξαίρεση Πολιτογραφήσεων ο Κ. Κυπριανού

Καταθέτει την Πέμπτη ενώπιον της Ερευνητικής Επιτροπής των Κατ’ Εξαίρεση Πολιτογραφήσεων Αλλοδαπών...

34' ΠΡΙΝ

Έφυγε ο «Κόκος» ο γνωστός πελεκάνος της Πάφου

«Έφυγε» από τη ζωή ο Κόκος ο πελεκάνος που άφησε εποχή στο λιμανάκι της Κάτω Πάφου Ο Κόκος...

1 ΩΡΑ ΠΡΙΝ

Ελεγκτική Υπηρεσία: Ελλείψεις στις αποδείξεις του περιβαλλοντικού τέλους των ελαστικών

Συστάσεις δίνει η Ελεγκτική Υπηρείσα στην Έκθεση της με θέμα «Διαχείριση Αποβλήτων Ελαστικών...

1 ΩΡΑ ΠΡΙΝ

Χάθηκαν τα ίχνη του 13χρονου Κωνσταντίνου στη Λευκωσία – Μήπως τον έχετε δει; [ΦΩΤΟ]

Καταγγέλθηκε στην Αστυνομία, ότι ελλείπει από τις 15/4/2021 από την οικία του στη Λευκωσία, ο...

2 ΩΡΕΣ ΠΡΙΝ

ΠΑΣΙΚΑ: Για να παραμείνει ζωντανή η βιομηχανία των κέντρων αναψυχής χρειάζεται οικονομική στήριξη

Ο Παγκύπριος Σύνδεσμος Ιδιοκτητών Κέντρων Αναψυχής (ΠΑΣΙΚΑ) σε ανακοίνωση του αναφέρει ότι η...

2 ΩΡΕΣ ΠΡΙΝ

Κορυφώνονται το βράδυ της Πέμπτης οι «Λυρίδες»

Οι Λυρίδες, η πρώτη αξιόλογη βροχή από «πεφταστέρια» της άνοιξης, θα κορυφωθούν στον ουρανό του...

2 ΩΡΕΣ ΠΡΙΝ

Πρόεδρος ΔΗΚΟ: O Πρόεδρος να δημοσιοποιήσει τη συνομιλία με Τσαβούσογλου

Ο Πρόεδρος του ΔΗΚΟ Νικόλας Παπαδόπουλος κάλεσε τον Πρόεδρο της Δημοκρατίας Νίκο Αναστασιάδη να...

Μέσα από το επίσημο κανάλι της στο youtube, η Ομόνοια μας παρουσιάζει τα γκολ του Μάρκο Τσέποβιτς με την πράσινη φανέλα. 

Ο πρόεδρος της Νέας Σαλαμίνας, Θουκής Θουκυδίδης μίλησε στον Super Sport FM 104,0 και την Κατερίνα...

Ο Αλεσάντρο Ντελ Πιέρο φαίνεται πως είναι αυτός ο οποίος θα πάρει τη θέση του Αντρέα Ανιέλι στην...

Η ΚΟΠ ενημερώνει... 👉Σε περίπτωση που ποδοσφαιριστής ή προπονητής ή οποιοσδήποτε άλλος...

52' ΠΡΙΝ

Λίβερπουλ: Επιστρέφουν στο Kop οι σημαίες [ΦΩΤΟ]

Την επιστροφή των σημαιών στο Kop έπειτα από την απόφαση της Λίβερπουλ, να αποχωρήσει από την...

1 ΩΡΑ ΠΡΙΝ

Θέλει τελικό ύστερα απο 30 χρόνια

Για τον Ολυμπιακό το κίνητρο είναι τεράστιο πάει στην Λεμεσό με το καλό 4-2 και σε καλή αγωνιστική...

*Της Δρ. Ανδρούλλας Ν. Μηλιώτου  «…GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAG…».  Μπορεί το πιο πάνω να μοιάζει με ασυναρτησίες, αλλά μια τέτοια ακολουθία, το DNA δηλαδή, είναι πραγματικά αξιοσημείωτη. Είναι παρούσα σε όλα τα...

Στην αρχή μας μοιάζει με παιχνίδι. Αργότερα νιώθουμε υπερήφανοι, που τα παιδιά μας καταφέρνουν να...

Τα συμπληρώματα διατροφής μπορούν να μειώσουν τον κίνδυνο Covid-19 στις γυναίκες, ωστόσο δεν...

Η Hyundai παρουσιάζει το Bayon, ένα ολότελα νέο, κομψό και στυλάτο SUV. To Bayon, με συμπαγές...

Τέσσερα χρόνια συμπληρώνονται σήμερα από την ημέρα που ο Στάθης Ψάλτης, ένας από τους πιο...

Η 94χρονη βασίλισσα Ελισάβετ πραγματοποίησε την πρώτη της δημόσια εμφάνιση μετά την κηδεία του...